Całkowity niedobór inhibitora plazminogenu typu aktywatora 1 z powodu mutacji z przesunięciem ramki cd

PCR przeprowadzono przez 35 cykli, z etapem denaturacji 1,0 do 1,5 minuty w 94 ° C i etapem wydłużania wynoszącym 2,5 minuty w 65 ° C lub 1,5 minuty w 72 ° C. Sekwencję DNA PAI-1 określono po subklonowaniu produktów PCR do DNA bakteriofaga M13, 14, 16 lub bezpośrednio za pomocą asymetrycznego PCR.18 Produkty PCR Exon 4 analizowano przez hybrydyzację z oligonukleotydami specyficznymi dla allelu, 19, które były specyficzne dla normalnej sekwencji. dla PAI-1 (ACTTACTATAGTTGAA) i sekwencji zmutowanej (ACTTACTATATAGTTGAA). Badania nad płytkami RNA
Płytkowy RNA wyizolowany z probanda i jej rodziców20 poddano odwrotnej transkrypcji ze starterem specyficznym dla PAI-1 (AGCCTGGTCATGTTGCC) i amplifikacji przez PCR, jak opisano w innym miejscu.14 Startery do PCR były AAGGATGAGATCAGCACCACAGACG i GGTGTCCCCGTGGTAGGGCAGTTCCAGGAT. Produkty PCR RNA analizowano za pomocą 2% elektroforezy w żelu agarozowym z barwieniem bromkiem etydyny i przez analizę hybrydyzacji swoistej dla oligonukleotydu allelowego, w której znakowane końcowo oligonukleotydy GTTCAACTATACTGAG i GTTCAACTATATACTGAG służyły odpowiednio jako sondy typu dzikiego i zmutowane.
Ekspresja i charakterystyka zmutowanego białka PAI-1
Fragment XbaI-EcoRV pET3A PAI-1 sklonowano w wektorze plazmidowym pSELECT-1 (Promega, Madison, Wis.), A oligonukleotyd AACAAGTTCAACTATATACTGAGTTCACC użyto do mutacji PAI-1 zgodnie z instrukcjami producenta. Zmutowana sekwencja została wprowadzona do pET3A PAI-1, a duplikaty konstruktów zawierające cDNA PAI-1 typu dzikiego lub zmutowanego ulegały ekspresji w szczepie Escherichia coli BL21 (DE3) pLysS, jak opisano uprzednio. 21. Lizaty komórek bakteryjnych odwirowano przy 25 000 x g przez 20 minut, a próbki supernatantów i ponownie zawieszone peletki poddano elektroforezie w żelu sodowym z dodecylosiarczanem-poliakrylamidem i metodą Western blotting16 za pomocą króliczego przeciwciała poliklonalnego anty-PAI-1. Supernatanty lizatów komórek bakteryjnych badano pod kątem hamowania aktywatora plazminogenu typu urokinazy, jak opisano wcześniej.
Wyniki
Brak wykrywalnego antygenu PAI-1 i aktywność w osoczu i płytkach probanda (ryc. 1), a także jej genetyczne podłoże (starożytny amish) sugerowały, że homozygotyczna defekt w obrębie genu PAI-1 był dla niej podstawą. stan braku. Ludzki gen PAI-1 zawiera dziewięć egzonów, obejmuje w przybliżeniu 12 kb i jest obecny na chromosomie 7.17, 22 analizy Southern blot DNA od pacjenta i jej rodzice nie ujawnili żadnych dowodów na całkowitą delecję lub przegrupowanie genów (dane nie pokazane). Aby zbadać subtelniejsze anomalie, zastosowano PCR do amplifikacji promotora PAI-1, całej sekwencji kodującej i wszystkich połączeń intron-ekson z genomowego DNA (Fig. 2). Analiza sekwencji DNA wykazała pojedynczą nieprawidłowość – homozygotyczną insercję o długości 2 pz (par zasad) na końcu 3 egzonu 4. Ta insercja jest zlokalizowana wewnątrz tetranukleotydu TATA, co sugeruje, że mutacja mogła powstać w wyniku polimerazy DNA. poślizg . 23 Dojrzałe białko PAI-1 ma długość 379 aminokwasów. Mutacja powoduje przesunięcie ramki odczytu po kodonie dla aminokwasu 210, powodując kodony 45 nowego kodonu stop (TGA) 45 w nieprawidłowej ramce odczytu
[podobne: lekarz medycyny pracy warszawa wola, liraglutyd, sonomed szczecin ]