Całkowity niedobór inhibitora plazminogenu typu aktywatora 1 z powodu mutacji z przesunięciem ramki ad

Kwadraty reprezentują męskich członków rodziny i okrążają żeńskie członki. Rodowód probanda (ze starej społeczności Amisha) pokazano na rycinie 1. Pacjentką była dziewięcioletnia dziewczynka, która miała kilka epizodów poważnego krwotoku, wszystko w odpowiedzi na uraz lub operację. W wieku trzech lat doznała niewielkiego urazu głowy, który doprowadził do krwiaka podkolanowego. Operacja usunięcia krwiaka była skomplikowana przez zagrażające życiu krwawienie, które wymagało transfuzji krwi. Kiedy dziecko miało osiem lat, krwotok podniebienny wymagał hospitalizacji i transfuzji. Nie było historii spontanicznego krwotoku, a wywiad rodzinny był ujemny z powodu nieprawidłowego krwawienia. Próba była normalnie fizycznie i rozwojowo normalna. Czas protrombinowy, czas częściowej tromboplastyny, liczba płytek krwi i poziomy VIII, IX i XIII w osoczu były prawidłowe, podobnie jak poziomy antygenu i aktywności czynnika von Willebranda w osoczu oraz antypasmina .2. Czas krwawienia wynosił 12 minut (normalnie, <9). Agregacja płytek in vitro była normalna. Całkowite i wolne poziomy plazmidu antygenu aktywatora plazminogenu tkankowego wynosiły odpowiednio 5,9 ng na mililitr (normalny, <8) i 3 ng na mililitr (normalny, <1,5), podczas gdy antygen PAI-1 i aktywność były niewykrywalne w obu plazmach. i płytki krwi (ryc. 1).
Metody
Ogólna charakterystyka genu i białka PAI-1
Po uzyskaniu świadomej zgody od pacjenta i jej rodziców, krew obwodową uzyskano przez nakłucie żyły i całkowite DNA komórkowe wytworzono z leukocytów, jak opisano wcześniej. Poziomy aktywności PAI-1 w osoczu i antygenu określono w uprzednio opisanych testach12, 15 z użyciem mniejsze zmiany. Przeprowadzono analizę Southerna genomowego DNA, jak opisano w innym miejscu, 16 z komplementarnym DNA PAI-1 (cDNA) stosowanym jako sonda17.
Sekwencjonowanie DNA i hybrydyzacja oligonukleotydów swoistych dla alleli
Rysunek 2. Rysunek 2. Identyfikacja mutacji powodująca niedobór PAI-1. Wstawienie dinukleotydu (TA) w eksonie 4 genu PAI-1 powoduje przesunięcie ramki odczytu i syntezę skróconego, niefunkcjonalnego białka. Lokalizacje starterów PCR użytych do amplifikacji genomowego DNA PAI-1 pokazano na górnym panelu. Normalna sekwencja PAI-1 z egzonu 4 i intronu D (bp 4969 do 4984 PAI-122) jest pokazana w lewym dolnym panelu, a odpowiednia sekwencja w DNA z probanda (generowana z puli ponad 30 niezależnych M13mp19 klony) jest pokazany w prawym dolnym panelu.
Reakcja łańcuchowa polimerazy (PCR) została przeprowadzona jak opisano wcześniej, 14 z siedmioma zestawami starterów oligonukleotydowych (Fig. 2). Następujące pary starterów użyto: AACCTAGACAATCACGTGGCTGGCT i AGAGAGTCAAGGTTCTTGTTACTGG (egzon 1), CACAGGGCAAGATGGGCGAAGACTC i ACGAGGTTAAGATCACACGGTGGTG (eksonu 2) ACAGTCTACCCTCAATTCAGCATAAGCCTC i TCTTGTTCTGTGACTCAGGCTGGAG (egzon 3), CCTGACTGCAGCCCTTTGACATACA i ACATCTAGAGCATTCCCTGTGGTCTTCCTC (egzon 4) TTGAACCGGATTCGGAGGCTGCAGT i TCAAACCCAGGCCACAGTTTCCCAT (egzon 5), ACAGAGCTCCAACCTTCACCTCCGTCCCTA i AGGAGCTTGGTAGCAATGGATCAGC (eksony 6 i 7) i GGAGGATCACTTGAGCCCATGAGTT i GTGATGGCAATGTGACTGGAACAGA (ekson 8 do końca 5 egzonu 9)
[więcej w: półpasiec objawy zdjęcia, tarczyca u mężczyzn objawy, sonomed szczecin ]